قناة سكاو في الواتساب
 


حسابنا في السناب شاتحسابنا في منصة Xقناتنا في اليوتيوبحسابنا في التيك توكقناتنا في التيليجرامقناة سكاو في الواتساب
 
وصف

العودة   منتديات سكاو > الكليات الجامعية > منتدى كـــلــية العـــــــلــوم > منتدى قسم الكيمياء الحيوية
التسجيل مشاركات اليوم البحث
   
   


اي استفسار لاي برنامج من برامج تطبيقات حاسوبيه للحيوي :)

منتدى قسم الكيمياء الحيوية

إضافة رد
 
أدوات الموضوع إبحث في الموضوع انواع عرض الموضوع
منتديات طلاب وطالبات جامعة الملك عبد العزيز منتديات طلاب وطالبات جامعة الملك عبد العزيز
  #1  
قديم 24-12-2010, 01:48 AM

.vib .vib غير متواجد حالياً

جامعي

 
تاريخ التسجيل: Sep 2008
نوع الدراسة: إنتظام
المستوى: السابع
الجنس: أنثى
المشاركات: 386
افتراضي رد: اي استفسار لاي برنامج من برامج تطبيقات حاسوبيه للحيوي :)


انا جايتكم وانا مكسوفه من الشي الا ح اطلبه

بس غصبا عني انا كنت غايبه في هذي المحاضره ومني فاهمه منها ولا شي

بنزل الواجب وشوفوا ادا قدرتوا تفهموني


Identifying Disease Genes Worksheet

In this activity, you will be given a nucleotide sequence found in real human DNA that is associated with a genetic disease when mutated. Your task is to compare the sequence you are given with known genes in the National Center for Biological Information (NCBI) website, using their Basic Logical Alignment Search Tool (BLAST) program.

Directions:
1) Go to the NCBI website, found at http://www.ncbi.nlm.nih.gov/, and click on the word “BLAST”, located on the dark blue bar near the top of the page.
2) Under the heading “Nucleotide”, click on the link for “Nucleotide-nucleotide BLAST”. One person should read the nucleotide sequence found on the index card you were given (in groups of 3) while the other person CAREFULLY types in the exact nucleotide sequence in the large empty “Search box.
3) When you or your partner finish typing, note in the space below any patterns you may have noticed about your sequence as it was being typed in.

__________________________________________________ ___________________

4) Now click on the “BLAST!” button, and after it brings you to the next screen, click on the “Format!” button and wait for your results.
5) On the webpage of your BLAST results, scroll down to the section with the horizontal colored lines, and carefully position your mouse on the “0” found below the word “Query”. Now slowly move your mouse below to the start of the first colored line. You should see the phrase “Mouse-over to show defline and scores, click to show alignments” in the white box change to indicate the name of the gene associated with the nucleotide sequence you typed in.
6) Slowly continue moving the mouse down each of the next 5 successive colored lines, taking note what appears in the white box. What seems to be the name of your human gene?

__________________________________________________ ___________________

7) Close the “results of BLAST window”, going back to the “formatting BLAST” page. Click on NCBI logo that appears in the top left hand corner of the page. This should bring you back to the NCBI home page.
8) Now scroll down till you see the word “Education”, the 3rd-to-last orange heading on the left-hand bar of the page, and click on it.
9) Scroll down till you see the word “Genomes & Genetics” (2nd-to-last orange heading), and click on “Genes and disease”.
10) Enter the name of the gene or genetic disease associated with your nucleotide sequence in the search box at the top of the page and click “Go”. Use the information returned with your search, as well as other resources on the NCBI website, to answer the questions on the other side of this page.






.................................................. .....................

SEQUENCE # 2
ATGTTTTATACAGGTGTAGCCTGTAAGAGATGAAGCCTGGTATTTA
TAGAAATTGACTTATTTTATTCTCATATTTACATGTGCATAATTTTCC
ATATGCCAGAAAAGTTGAATAGTATCAGATTCCAAATCT

SEQUENCE # 3
ATGTTGTGCAATATCCATCTACTGTAGTTAAGATATTCAGTAG
TTTGTTTTTCATAAGCATGTAATTGATCATATTTCTGCCAAGGATGT
GCCTTCAACTTTATAATTATAGTGTTGTAAAATATTTTTGTCTG

SEQUENCE # 4
ATGGCGACCCTGGAAAAGCTGATGAAGGCCTTCGAGTCCCTCAAGT
CCTTCCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGC
AGCAGCAGCAGCAGCAGCAGCAGCAACAGCCGCC

SEQUENCE # 5
ATGCGTCGAGGGCGTCTGCTGGAGATCGCCCTGGGATTTACCGTGCT
TTTAGCGTCCTACACGAGCCATGGGGCGGACGCCAATTTGGAGGC
TGGGAACGTGAAGGAAACCAGAGCCAGTCGGGCC

SEQUENCE # 6
ATGCCATCTTCCTTGATGTTGGAGGTACCTGCTCTGGCAGATTTCA
ACCGGGCTTGGACAGAACTTACCGACTGGCTTTCTCTGCTTGATC
AAGTTATAAAATCACAGAGGGTGATGGTGGGTGACCTT

SEQUENCE # 7
ATGCCGCCCAAAACCCCCCGAAAAACGGCCGCCACCGCCGCCGCTGC
CGCCGCGGAACCCCCGGCACCGCCGCCGCCGCCCCCTCCTGAGGAG
GACCCAGAGCAGGACAGCGGCCCGGAGGAC

SEQUENCE # 8
ATGGCGGGTCTGACGGCGGCGGCCCCGCGGCCCGGAGTCCTCCTG
CTCCTGCTGTCCATCCTCCACCCCTCTCGGCCTGGAGGGGTCCCTG
GGGCCATTCCTGGTGGAGTTCCTGGAGGAGTCTT
رد مع اقتباس

 

منتديات طلاب وطالبات جامعة الملك عبد العزيز منتديات طلاب وطالبات جامعة الملك عبد العزيز
قديم 24-12-2010, 09:56 PM   #2

ترانيم الكفاح

جامعي

الصورة الرمزية ترانيم الكفاح

 
تاريخ التسجيل: Jun 2010
التخصص: كيـ حيـويـه ــمياء
نوع الدراسة: إنتظام
المستوى: متخرج
الجنس: أنثى
المشاركات: 194
افتراضي رد: اي استفسار لاي برنامج من برامج تطبيقات حاسوبيه للحيوي :)

[quote=.vib;3224604]انا جايتكم وانا مكسوفه من الشي الا ح اطلبه

بس غصبا عني انا كنت غايبه في هذي المحاضره ومني فاهمه منها ولا شي

بنزل الواجب وشوفوا ادا قدرتوا تفهموني


Identifying Disease Genes Worksheet

In this activity, you will be given a nucleotide sequence found in real human DNA that is associated with a genetic disease when mutated. Your task is to compare the sequence you are given with known genes in the National Center for Biological Information (NCBI) website, using their Basic Logical Alignment Search Tool (BLAST) program.

Directions:
1) Go to the NCBI website, found at http://www.ncbi.nlm.nih.gov/, and click on the word “BLAST”, located on the dark blue bar near the top of the page.
2) Under the heading “Nucleotide”, click on the link for “Nucleotide-nucleotide BLAST”. One person should read the nucleotide sequence found on the index card you were given (in groups of 3) while the other person CAREFULLY types in the exact nucleotide sequence in the large empty “Search box.
3) When you or your partner finish typing, note in the space below any patterns you may have noticed about your sequence as it was being typed in.

__________________________________________________ ___________________

4) Now click on the “BLAST!” button, and after it brings you to the next screen, click on the “Format!” button and wait for your results.
5) On the webpage of your BLAST results, scroll down to the section with the horizontal colored lines, and carefully position your mouse on the “0” found below the word “Query”. Now slowly move your mouse below to the start of the first colored line. You should see the phrase “Mouse-over to show defline and scores, click to show alignments” in the white box change to indicate the name of the gene associated with the nucleotide sequence you typed in.
6) Slowly continue moving the mouse down each of the next 5 successive colored lines, taking note what appears in the white box. What seems to be the name of your human gene?


كل الكلام الي فوق حأختصر لك
اول شيء تروحي للموقع ـــــــــــــ> وبعدين تختاري كلمة plast حتكون على يمينك ـــــــــــــ> وبعدين حتنفتح لك صفحه وتختاري nucleotid plast ــــــــــــــــ> وبعدين حتطلع لك صفجة الفراغ الي حتلصقي فيه السلسله الجينيه تبعك بافأره ــــــــــ> وبعدين انزلي لاخر الصفحه الي الصقتي فيها سلسلتك واظغطي على كلمة plast الي في اطار ازرق ــــــــــــ>نتظري دقائق حتى تفتح لك الصفحه المطلوبه شوفيها على هالرابط http://blast.ncbi.nlm.nih.gov/Blast.cgi

ولاحظي انو حيكون هناك 5 الوان لاماكن الكروموسومات وعندما تمررين الماوس على الخطوط الحمراء السفلى تلاحضي تغير في اسامي الجينات وهذا تريدك ان تسنتجي الموقع الجيني للانسان



__________________________________________________ ___________________

7) Close the “results of BLAST window”, going back to the “formatting BLAST” page. Click on NCBI logo that appears in the top left hand corner of the page. This should bring you back to the NCBI home page.
8) Now scroll down till you see the word “Education”, the 3rd-to-last orange heading on the left-hand bar of the page, and click on it.
9) Scroll down till you see the word “Genomes & Genetics” (2nd-to-last orange heading), and click on “Genes and disease”.
10) Enter the name of the gene or genetic disease associated with your nucleotide sequence in the search box at the top of the page and click “Go”. Use the information returned with your search, as well as other resources on the NCBI website, to answer the questions on the other side of this page.


بالنسبه لهذا الكلام ما فهمت ولا شيء

بس انا متأكده انو هذا فقط شرح لكم وليس هذا الواجب ؟؟؟؟؟؟؟؟؟؟؟؟

 

ترانيم الكفاح غير متواجد حالياً   رد مع اقتباس
 

إضافة رد


تعليمات المشاركة
لا تستطيع إضافة مواضيع جديدة
لا تستطيع الرد على المواضيع
لا تستطيع إرفاق ملفات
لا تستطيع تعديل مشاركاتك

BB code is متاحة
كود [IMG] متاحة
كود HTML معطلة

الانتقال السريع

 


الساعة الآن 08:46 PM


Powered by vBulletin® Version 3.8.9 Beta 3
Copyright ©2000 - 2025, vBulletin Solutions, Inc.
Ads Organizer 3.0.3 by Analytics - Distance Education

أن كل ما ينشر في المنتدى لا يمثل رأي الإدارة وانما يمثل رأي أصحابها

جميع الحقوق محفوظة لشبكة سكاو

2003-2025